cầu số đề

Kênh 555win: · 2025-08-25 01:50:05

555win cung cấp cho bạn một cách thuận tiện, an toàn và đáng tin cậy [cầu số đề]

Biological Unit for 6Q2B: tetrameric; determined by author and by software (PISA) Molecular Graphic ?

6Q2b Potassium, NH4OAc Extraction, Atomic Absorption I 7A2 X-ray Diffraction, unspecified 7B1a2 Optical Analysis, Full Grain Count hyd1 PSDA, Hydrometer, sand fractions wet sieved *** Preparation Codes *** Code Description / List of Methods Sjj The air-dried soil passing a No. 10-mesh sieve hyd1, 6C2b, 6G2a, 6N2a, 6O2a, 6Q2b, 7A2, 7B1a2

Use the inputs below to select a particular DNA-protein interface to visualize. By default, only interactions with the DNA major groove, minor groove or bases are shown. To turn on backbone contacts, select specific secondary structure interactions, and set custom interaction criteria, click the show advanced options button below. model: dna entity: protein chains: DNA Moieties: …

wwPDB: Worldwide Protein Data BankSummary information: Title: Crystal Structure of Putative MarR Family Transcriptional Regulator from Listeria monocytogenes complexed with 26mer DNA

legend pdf interface graph footprint logo interface matrix atomic interactions interface residue numbers

Aug 7, 2019 · Crystal Structure of Putative MarR Family Transcriptional Regulator from Listeria monocytogenes complexed with 26mer DNA

Ligand information >6q2b Chain C (length=26) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure] cctattgttgcaattgcaacaatagg Receptor-Ligand Complex Structure Global view Local view Structure summary [Spin on] [Spin off] [Reset] [High quality] [Low quality]

Bài viết được đề xuất:

ket qua xo so mien bac

xs quang tri

xổ số kiến thiết ninh thuận

xổ số thành phố thứ 2 hàng tuần